Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 114787 |
| Name | oriT_FDAARGOS_1157|unnamed1  |
| Organism | Streptococcus dysgalactiae strain FDAARGOS_1157 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP068058 (6190..6244 [-], 55 nt) |
| oriT length | 55 nt |
| IRs (inverted repeats) | 1..7, 9..15 (GTTGATA..TATCAAC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 55 nt
>oriT_FDAARGOS_1157|unnamed1
GTTGATACTATCAACTCCACACGATATGTGGGGACAGTTTCCCTTATGCTCTTTT
GTTGATACTATCAACTCCACACGATATGTGGGGACAGTTTCCCTTATGCTCTTTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 15222 | GenBank | NZ_CP068058 |
| Plasmid name | FDAARGOS_1157|unnamed1 | Incompatibility group | - |
| Plasmid size | 6534 bp | Coordinate of oriT [Strand] | 6190..6244 [-] |
| Host baterium | Streptococcus dysgalactiae strain FDAARGOS_1157 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |