Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 114721 |
| Name | oriT_C11|unnamed2  |
| Organism | Comamonas sp. C11 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP101745 (39380..39428 [+], 49 nt) |
| oriT length | 49 nt |
| IRs (inverted repeats) | 21..27, 31..37 (ACATGGC..GCCATGT) |
| Location of nic site | 9..10 |
| Conserved sequence flanking the nic site |
ATGCGGATTG |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 49 nt
>oriT_C11|unnamed2
CAGGATGCGGATTGTCATACACATGGCTACGCCATGTTCCTGCCAATCC
CAGGATGCGGATTGTCATACACATGGCTACGCCATGTTCCTGCCAATCC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 15156 | GenBank | NZ_CP101745 |
| Plasmid name | C11|unnamed2 | Incompatibility group | - |
| Plasmid size | 39872 bp | Coordinate of oriT [Strand] | 39380..39428 [+] |
| Host baterium | Comamonas sp. C11 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | arsA |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |