Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 114685 |
| Name | oriT_pSR5  |
| Organism | Aminobacter sp. SR38 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP062117 (21284..21337 [+], 54 nt) |
| oriT length | 54 nt |
| IRs (inverted repeats) | 25..31, 36..42 (ACGTCGC..GCGACGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 54 nt
>oriT_pSR5
CCCCGCCAGGGCCGGTAAGCAAGGACGTCGCGTCAGCGACGTATAATTGCGCCC
CCCCGCCAGGGCCGGTAAGCAAGGACGTCGCGTCAGCGACGTATAATTGCGCCC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 85112..93638
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| IG197_RS32605 (IG197_32605) | 80347..81681 | - | 1335 | WP_192321194 | plasmid replication protein RepC | - |
| IG197_RS32610 (IG197_32610) | 81913..82914 | - | 1002 | WP_192321196 | plasmid partitioning protein RepB | - |
| IG197_RS32615 (IG197_32615) | 82911..84122 | - | 1212 | WP_192321198 | plasmid partitioning protein RepA | - |
| IG197_RS32620 (IG197_32620) | 84483..85115 | + | 633 | WP_192321199 | acyl-homoserine-lactone synthase TraI | - |
| IG197_RS32625 (IG197_32625) | 85112..86083 | + | 972 | WP_192321201 | P-type conjugative transfer ATPase TrbB | virB11 |
| IG197_RS32630 (IG197_32630) | 86073..86480 | + | 408 | WP_192321203 | conjugal transfer pilin TrbC | virB2 |
| IG197_RS32635 (IG197_32635) | 86473..86772 | + | 300 | WP_192321205 | conjugal transfer protein TrbD | virB3 |
| IG197_RS36435 | 86783..88897 | + | 2115 | WP_246765510 | P-type conjugative transfer protein TrbJ | virb4 |
| IG197_RS32650 (IG197_32650) | 88894..89130 | + | 237 | WP_192321207 | entry exclusion protein TrbK | - |
| IG197_RS32655 (IG197_32655) | 89124..90314 | + | 1191 | WP_192321209 | P-type conjugative transfer protein TrbL | virB6 |
| IG197_RS32660 (IG197_32660) | 90333..90995 | + | 663 | WP_192321211 | conjugal transfer protein TrbF | virB8 |
| IG197_RS32665 (IG197_32665) | 91045..91854 | + | 810 | WP_246765518 | P-type conjugative transfer protein TrbG | virB9 |
| IG197_RS32670 (IG197_32670) | 91854..92315 | + | 462 | WP_192321213 | conjugal transfer protein TrbH | - |
| IG197_RS32675 (IG197_32675) | 92328..93638 | + | 1311 | WP_192321215 | IncP-type conjugal transfer protein TrbI | virB10 |
| IG197_RS32680 (IG197_32680) | 93688..93987 | + | 300 | WP_246765511 | transposase | - |
| IG197_RS32685 (IG197_32685) | 94067..94363 | + | 297 | WP_192321219 | hypothetical protein | - |
| IG197_RS36440 | 94369..94844 | + | 476 | Protein_92 | FAD-linked oxidase C-terminal domain-containing protein | - |
| IG197_RS32700 (IG197_32700) | 94998..95378 | - | 381 | WP_192321225 | RidA family protein | - |
| IG197_RS32705 (IG197_32705) | 95418..96668 | - | 1251 | WP_192321226 | D-amino acid dehydrogenase | - |
| IG197_RS32710 (IG197_32710) | 96696..97829 | - | 1134 | WP_192321228 | alanine racemase | - |
| IG197_RS32715 (IG197_32715) | 97952..98416 | + | 465 | WP_192321230 | Lrp/AsnC family transcriptional regulator | - |
Host bacterium
| ID | 15120 | GenBank | NZ_CP062117 |
| Plasmid name | pSR5 | Incompatibility group | - |
| Plasmid size | 163970 bp | Coordinate of oriT [Strand] | 21284..21337 [+] |
| Host baterium | Aminobacter sp. SR38 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |