Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 114661 |
| Name | oriT_pRSM-7096_3  |
| Organism | Raoultella ornithinolytica strain RSM7096 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP132014 (29695..29744 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..13, 18..24 (GCAAAAT..ATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pRSM-7096_3
AAATCTGCAAAATATTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATATTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 29142..35896
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| Q8726_RS27710 (Q8726_27710) | 24244..24972 | + | 729 | WP_305841942 | plasmid SOS inhibition protein A | - |
| Q8726_RS27715 (Q8726_27715) | 24969..25056 | + | 88 | Protein_32 | theronine dehydrogenase | - |
| Q8726_RS27720 (Q8726_27720) | 25376..25705 | + | 330 | WP_305841944 | type II toxin-antitoxin system RelE/ParE family toxin | - |
| Q8726_RS27725 (Q8726_27725) | 25686..25967 | + | 282 | WP_004118961 | helix-turn-helix transcriptional regulator | - |
| Q8726_RS27730 (Q8726_27730) | 26786..27061 | + | 276 | WP_032700867 | hypothetical protein | - |
| Q8726_RS27735 (Q8726_27735) | 27118..27276 | + | 159 | WP_162180130 | hypothetical protein | - |
| Q8726_RS27740 (Q8726_27740) | 27302..27649 | + | 348 | WP_032736875 | hypothetical protein | - |
| Q8726_RS27745 (Q8726_27745) | 27743..27889 | + | 147 | WP_032700834 | hypothetical protein | - |
| Q8726_RS27750 (Q8726_27750) | 28574..29104 | + | 531 | WP_032716647 | antirestriction protein | - |
| Q8726_RS27755 (Q8726_27755) | 29142..29621 | - | 480 | WP_032716648 | transglycosylase SLT domain-containing protein | virB1 |
| Q8726_RS27760 (Q8726_27760) | 30052..30444 | + | 393 | WP_032736874 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| Q8726_RS27765 (Q8726_27765) | 30683..31384 | + | 702 | WP_032736872 | hypothetical protein | - |
| Q8726_RS27770 (Q8726_27770) | 31469..31669 | + | 201 | WP_060415469 | TraY domain-containing protein | - |
| Q8726_RS27775 (Q8726_27775) | 31738..32106 | + | 369 | WP_032736871 | type IV conjugative transfer system pilin TraA | - |
| Q8726_RS27780 (Q8726_27780) | 32120..32425 | + | 306 | WP_032736870 | type IV conjugative transfer system protein TraL | traL |
| Q8726_RS27785 (Q8726_27785) | 32445..33011 | + | 567 | WP_032736869 | type IV conjugative transfer system protein TraE | traE |
| Q8726_RS27790 (Q8726_27790) | 32998..33732 | + | 735 | WP_032736867 | type-F conjugative transfer system secretin TraK | traK |
| Q8726_RS27795 (Q8726_27795) | 33732..35153 | + | 1422 | WP_032736866 | F-type conjugal transfer pilus assembly protein TraB | traB |
| Q8726_RS27800 (Q8726_27800) | 35327..35896 | + | 570 | WP_305841951 | type IV conjugative transfer system lipoprotein TraV | traV |
| Q8726_RS27805 (Q8726_27805) | 36008..36286 | + | 279 | WP_032736865 | hypothetical protein | - |
| Q8726_RS27810 (Q8726_27810) | 36371..36772 | + | 402 | WP_032736864 | hypothetical protein | - |
| Q8726_RS27815 (Q8726_27815) | 36769..37068 | + | 300 | WP_032736863 | hypothetical protein | - |
| Q8726_RS27820 (Q8726_27820) | 37156..37539 | + | 384 | WP_278078927 | hypothetical protein | - |
| Q8726_RS27825 (Q8726_27825) | 37632..38093 | + | 462 | Protein_54 | TraC family protein | - |
Host bacterium
| ID | 15096 | GenBank | NZ_CP132014 |
| Plasmid name | pRSM-7096_3 | Incompatibility group | IncFIB |
| Plasmid size | 38149 bp | Coordinate of oriT [Strand] | 29695..29744 [-] |
| Host baterium | Raoultella ornithinolytica strain RSM7096 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |