Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 114652 |
| Name | oriT_psn0606-3  |
| Organism | Shigella sonnei strain sn0606 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_OQ230389 (27701..27753 [+], 53 nt) |
| oriT length | 53 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 53 nt
>oriT_psn0606-3
CACACGATTGTAACATGACCGGAACGGTCTTGTGTACAATCGGTATCGTGCCT
CACACGATTGTAACATGACCGGAACGGTCTTGTGTACAATCGGTATCGTGCCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 50526..62038
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| RA115_RS00335 (psn0606-3_00064) | 46496..47002 | + | 507 | WP_001358485 | CaiF/GrlA family transcriptional regulator | - |
| RA115_RS00340 (psn0606-3_00065) | 46995..47189 | + | 195 | WP_000049865 | DUF1187 family protein | - |
| RA115_RS00345 (psn0606-3_00066) | 47235..48188 | + | 954 | WP_072105959 | SPFH domain-containing protein | - |
| RA115_RS00350 (psn0606-3_00067) | 48261..48704 | + | 444 | WP_000964840 | NfeD family protein | - |
| RA115_RS00355 (psn0606-3_00068) | 48708..48878 | + | 171 | WP_000550721 | hypothetical protein | - |
| RA115_RS00360 (psn0606-3_00069) | 48889..49551 | + | 663 | WP_001419740 | hypothetical protein | - |
| RA115_RS00365 (psn0606-3_00070) | 49520..49702 | + | 183 | WP_022540746 | hypothetical protein | - |
| RA115_RS00370 (psn0606-3_00071) | 49699..49950 | + | 252 | WP_015387362 | hypothetical protein | - |
| RA115_RS00375 (psn0606-3_00072) | 49966..50268 | + | 303 | WP_001360345 | hypothetical protein | - |
| RA115_RS00380 (psn0606-3_00073) | 50265..50522 | + | 258 | WP_000739144 | hypothetical protein | - |
| RA115_RS00385 (psn0606-3_00074) | 50526..51512 | + | 987 | WP_001419739 | type IV secretion system protein | virB6 |
| RA115_RS00390 (psn0606-3_00075) | 51518..52165 | + | 648 | WP_001419738 | type IV secretion system protein | - |
| RA115_RS00395 (psn0606-3_00076) | 52169..52405 | + | 237 | WP_000750964 | EexN family lipoprotein | - |
| RA115_RS00400 (psn0606-3_00077) | 52452..53261 | - | 810 | WP_001419737 | DUF5710 domain-containing protein | - |
| RA115_RS00405 (psn0606-3_00078) | 53309..53941 | + | 633 | WP_001419736 | hypothetical protein | - |
| RA115_RS00410 (psn0606-3_00079) | 54008..54307 | + | 300 | WP_000835763 | TrbM/KikA/MpfK family conjugal transfer protein | - |
| RA115_RS00415 (psn0606-3_00080) | 54310..55545 | + | 1236 | WP_001419735 | TcpQ domain-containing protein | - |
| RA115_RS00420 (psn0606-3_00081) | 55638..55988 | + | 351 | WP_080843471 | type IV pilus biogenesis protein PilM | - |
| RA115_RS00425 (psn0606-3_00083) | 56328..56726 | + | 399 | WP_001708012 | hypothetical protein | - |
| RA115_RS00430 (psn0606-3_00084) | 56747..57331 | + | 585 | WP_001401693 | lytic transglycosylase domain-containing protein | virB1 |
| RA115_RS00435 (psn0606-3_00085) | 57331..57621 | + | 291 | WP_000865479 | conjugal transfer protein | - |
| RA115_RS00440 (psn0606-3_00086) | 57692..58012 | + | 321 | WP_000362081 | VirB3 family type IV secretion system protein | virB3 |
| RA115_RS00445 (psn0606-3_00087) | 58018..60375 | + | 2358 | WP_015387356 | VirB4 family type IV secretion system protein | virb4 |
| RA115_RS00450 (psn0606-3_00089) | 60538..61272 | + | 735 | WP_000432282 | virB8 family protein | virB8 |
| RA115_RS00455 (psn0606-3_00090) | 61269..61793 | + | 525 | WP_305809447 | TrbG/VirB9 family P-type conjugative transfer protein | virB9 |
| RA115_RS00460 (psn0606-3_00091) | 61748..62038 | + | 291 | WP_251287733 | TrbG/VirB9 family P-type conjugative transfer protein | virB9 |
Host bacterium
| ID | 15087 | GenBank | NZ_OQ230389 |
| Plasmid name | psn0606-3 | Incompatibility group | IncI2 |
| Plasmid size | 62086 bp | Coordinate of oriT [Strand] | 27701..27753 [+] |
| Host baterium | Shigella sonnei strain sn0606 |
Cargo genes
| Drug resistance gene | blaCTX-M-55 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |