Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   114578
Name   oriT_pCIT-ce4a in_silico
Organism   Citrobacter sp. CFNIH10
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP026215 (1524..1583 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pCIT-ce4a
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTAAACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   15013 GenBank   NZ_CP026215
Plasmid name   pCIT-ce4a Incompatibility group   Col440I
Plasmid size   7304 bp Coordinate of oriT [Strand]   1524..1583 [+]
Host baterium   Citrobacter sp. CFNIH10

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -