Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 114578
• Name: oriT_pCIT-ce4a
• Organism: Citrobacter sp. CFNIH10
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP026215 (1524..1583 [+], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_pCIT-ce4a
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTAAACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 15013
• GenBank: NZ_CP026215
• Plasmid name: pCIT-ce4a
• Incompatibility group: Col440I
• Plasmid size: 7304 bp
• Coordinate of oriT [Strand]: 1524..1583 [+]
• Host baterium: Citrobacter sp. CFNIH10

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -