Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 114536
• Name: oriT_pDR25-4
• Organism: Enterobacter sp. JH25
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP091323 (2155..2214 [-], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_pDR25-4
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGCAGCGCTAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 14971
• GenBank: NZ_CP091323
• Plasmid name: pDR25-4
• Incompatibility group: ColRNAI
• Plasmid size: 12474 bp
• Coordinate of oriT [Strand]: 2155..2214 [-]
• Host baterium: Enterobacter sp. JH25

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -