Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 114521 |
| Name | oriT_pLCAMS1-2  |
| Organism | Leuconostoc carnosum strain AMS1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP130705 (12167..12202 [+], 36 nt) |
| oriT length | 36 nt |
| IRs (inverted repeats) | 1..6, 17..22 (CACCAC..GTGGTG) |
| Location of nic site | 18..19 |
| Conserved sequence flanking the nic site |
TGTGTGGTGT |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 36 nt
>oriT_pLCAMS1-2
CACCACCAATTTATGTGTGGTGTGTAAGTGCGCATT
CACCACCAATTTATGTGTGGTGTGTAAGTGCGCATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14956 | GenBank | NZ_CP130705 |
| Plasmid name | pLCAMS1-2 | Incompatibility group | - |
| Plasmid size | 14988 bp | Coordinate of oriT [Strand] | 12167..12202 [+] |
| Host baterium | Leuconostoc carnosum strain AMS1 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |