Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 114513 |
| Name | oriT_p121BS  |
| Organism | Lactobacillus sp. PC121B |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_004957 (1815..1852 [-], 38 nt) |
| oriT length | 38 nt |
| IRs (inverted repeats) | 1..6, 10..15 (CTTTAC..GTAAAG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 38 nt
>oriT_p121BS
CTTTACGAAGTAAAGTATAGTGGGTTATACTTTACATG
CTTTACGAAGTAAAGTATAGTGGGTTATACTTTACATG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14948 | GenBank | NC_004957 |
| Plasmid name | p121BS | Incompatibility group | - |
| Plasmid size | 4234 bp | Coordinate of oriT [Strand] | 1815..1852 [-] |
| Host baterium | Lactobacillus sp. PC121B |
Cargo genes
| Drug resistance gene | erm(T) |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |