Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 114510 |
| Name | oriT_ECL352|unnamed4  |
| Organism | Enterobacter cloacae complex sp. ECL352 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP083713 (3289..3347 [-], 59 nt) |
| oriT length | 59 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 59 nt
>oriT_ECL352|unnamed4
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14945 | GenBank | NZ_CP083713 |
| Plasmid name | ECL352|unnamed4 | Incompatibility group | Col440I |
| Plasmid size | 4461 bp | Coordinate of oriT [Strand] | 3289..3347 [-] |
| Host baterium | Enterobacter cloacae complex sp. ECL352 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |