Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 114475 |
Name | oriT_pYpstbSP1303.1 |
Organism | Yersinia pseudotuberculosis strain SP-1303 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP130904 (5020..5079 [+], 60 nt) |
oriT length | 60 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pYpstbSP1303.1
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 14910 | GenBank | NZ_CP130904 |
Plasmid name | pYpstbSP1303.1 | Incompatibility group | Col440I |
Plasmid size | 5546 bp | Coordinate of oriT [Strand] | 5020..5079 [+] |
Host baterium | Yersinia pseudotuberculosis strain SP-1303 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |