Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   114475
Name   oriT_pYpstbSP1303.1 in_silico
Organism   Yersinia pseudotuberculosis strain SP-1303
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP130904 (5020..5079 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pYpstbSP1303.1
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14910 GenBank   NZ_CP130904
Plasmid name   pYpstbSP1303.1 Incompatibility group   Col440I
Plasmid size   5546 bp Coordinate of oriT [Strand]   5020..5079 [+]
Host baterium   Yersinia pseudotuberculosis strain SP-1303

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -