Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 114440
• Name: oriT_pT32SS
• Organism: Shigella flexneri strain 2aT32
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP106859 (1678..1737 [+], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_pT32SS
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 14875
• GenBank: NZ_CP106859
• Plasmid name: pT32SS
• Incompatibility group: ColRNAI
• Plasmid size: 4110 bp
• Coordinate of oriT [Strand]: 1678..1737 [+]
• Host baterium: Shigella flexneri strain 2aT32

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -