Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   114440
Name   oriT_pT32SS in_silico
Organism   Shigella flexneri strain 2aT32
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP106859 (1678..1737 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pT32SS
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14875 GenBank   NZ_CP106859
Plasmid name   pT32SS Incompatibility group   ColRNAI
Plasmid size   4110 bp Coordinate of oriT [Strand]   1678..1737 [+]
Host baterium   Shigella flexneri strain 2aT32

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -