Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   114410
Name   oriT_ZLp4b|unnamed2 in_silico
Organism   Ligilactobacillus salivarius strain ZLp4b
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP062073 (25596..25633 [-], 38 nt)
oriT length   38 nt
IRs (inverted repeats)      14..22, 29..37  (TAAAGTATA..TATACTTTA)
 2..8, 13..19  (ACTTTAT..ATAAAGT)
Location of nic site      27..28
Conserved sequence flanking the
  nic site  
 
 GTGTGTTATA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 38 nt

>oriT_ZLp4b|unnamed2
CACTTTATGAATATAAAGTATAGTGTGTTATACTTTAC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14845 GenBank   NZ_CP062073
Plasmid name   ZLp4b|unnamed2 Incompatibility group   -
Plasmid size   31824 bp Coordinate of oriT [Strand]   25596..25633 [-]
Host baterium   Ligilactobacillus salivarius strain ZLp4b

Cargo genes


Drug resistance gene   tet(L), tet(M)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -