Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   114405
Name   oriT_pJE05 in_silico
Organism   Erwinia sp. Ejp617
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NC_017444 (1249..1308 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pJE05
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14840 GenBank   NC_017444
Plasmid name   pJE05 Incompatibility group   ColRNAI
Plasmid size   2691 bp Coordinate of oriT [Strand]   1249..1308 [-]
Host baterium   Erwinia sp. Ejp617

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -