Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 114405
• Name: oriT_pJE05
• Organism: Erwinia sp. Ejp617
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NC_017444 (1249..1308 [-], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_pJE05
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 14840
• GenBank: NC_017444
• Plasmid name: pJE05
• Incompatibility group: ColRNAI
• Plasmid size: 2691 bp
• Coordinate of oriT [Strand]: 1249..1308 [-]
• Host baterium: Erwinia sp. Ejp617

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -