Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 114366 |
| Name | oriT_pLL1-4kb  |
| Organism | Lactobacillus sp. strain LL1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MK858222 (2805..2859 [+], 55 nt) |
| oriT length | 55 nt |
| IRs (inverted repeats) | 1..7, 9..15 (GTTGGTA..TACCAAC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 55 nt
>oriT_pLL1-4kb
GTTGGTACTACCAACTCCACACGGCACGTGGGGACTGTTTCCCTTATGCTCTTTT
GTTGGTACTACCAACTCCACACGGCACGTGGGGACTGTTTCCCTTATGCTCTTTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14801 | GenBank | NZ_MK858222 |
| Plasmid name | pLL1-4kb | Incompatibility group | - |
| Plasmid size | 4016 bp | Coordinate of oriT [Strand] | 2805..2859 [+] |
| Host baterium | Lactobacillus sp. strain LL1 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |