Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 114316
• Name: oriT_pTB509
• Organism: Salmonella sp. SSDFZ54
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP034828 (594..653 [+], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_pTB509
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGCAGCGCTAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 14751
• GenBank: NZ_CP034828
• Plasmid name: pTB509
• Incompatibility group: Col440I
• Plasmid size: 2020 bp
• Coordinate of oriT [Strand]: 594..653 [+]
• Host baterium: Salmonella sp. SSDFZ54

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -