Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   114315
Name   oriT_pTB507 in_silico
Organism   Salmonella sp. SSDFZ54
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP034826 (706..765 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pTB507
GGGTGTCGGGGCGCAGCCCTGACCCAGTTCACAGAGCGATAGCGATGTGTATACTGGCTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14750 GenBank   NZ_CP034826
Plasmid name   pTB507 Incompatibility group   -
Plasmid size   3373 bp Coordinate of oriT [Strand]   706..765 [-]
Host baterium   Salmonella sp. SSDFZ54

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -