Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   114303
Name   oriT_P7704|unnamed3 in_silico
Organism   Salmonella enterica subsp. enterica serovar Java strain P7704
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP065188 (2745..2802 [-], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT_P7704|unnamed3
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14738 GenBank   NZ_CP065188
Plasmid name   P7704|unnamed3 Incompatibility group   Col440I
Plasmid size   3198 bp Coordinate of oriT [Strand]   2745..2802 [-]
Host baterium   Salmonella enterica subsp. enterica serovar Java strain P7704

Cargo genes


Drug resistance gene   qnrB19
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -