Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   114296
Name   oriT_p12-6919.3 in_silico
Organism   Salmonella enterica subsp. enterica serovar 14[5]12:i:- strain PNCS014868
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP039606 (4243..4302 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_p12-6919.3
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14731 GenBank   NZ_CP039606
Plasmid name   p12-6919.3 Incompatibility group   ColRNAI
Plasmid size   4697 bp Coordinate of oriT [Strand]   4243..4302 [-]
Host baterium   Salmonella enterica subsp. enterica serovar 14[5]12:i:- strain PNCS014868

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -