Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   114289
Name   oriT_p09-0642.2 in_silico
Organism   Salmonella enterica subsp. enterica serovar 14[5]12:i:- strain PNCS014852
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP039571 (2773..2830 [+], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT_p09-0642.2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14724 GenBank   NZ_CP039571
Plasmid name   p09-0642.2 Incompatibility group   Col440II
Plasmid size   4418 bp Coordinate of oriT [Strand]   2773..2830 [+]
Host baterium   Salmonella enterica subsp. enterica serovar 14[5]12:i:- strain PNCS014852

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -