Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 114289 |
| Name | oriT_p09-0642.2  |
| Organism | Salmonella enterica subsp. enterica serovar 14[5]12:i:- strain PNCS014852 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP039571 (2773..2830 [+], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_p09-0642.2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14724 | GenBank | NZ_CP039571 |
| Plasmid name | p09-0642.2 | Incompatibility group | Col440II |
| Plasmid size | 4418 bp | Coordinate of oriT [Strand] | 2773..2830 [+] |
| Host baterium | Salmonella enterica subsp. enterica serovar 14[5]12:i:- strain PNCS014852 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |