Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   114287
Name   oriT_p10-2080.3 in_silico
Organism   Salmonella enterica subsp. enterica serovar 14[5]12:i:- strain PNCS014855
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP039575 (1045..1119 [+], 75 nt)
oriT length   75 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 75 nt

>oriT_p10-2080.3
GTCGGGGCGAAGCCCTGACCAAGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14722 GenBank   NZ_CP039575
Plasmid name   p10-2080.3 Incompatibility group   ColRNAI
Plasmid size   3003 bp Coordinate of oriT [Strand]   1045..1119 [+]
Host baterium   Salmonella enterica subsp. enterica serovar 14[5]12:i:- strain PNCS014855

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -