Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   114286
Name   oriT_p10-2080.2 in_silico
Organism   Salmonella enterica subsp. enterica serovar 14[5]12:i:- strain PNCS014855
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP039574 (1396..1453 [-], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT_p10-2080.2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14721 GenBank   NZ_CP039574
Plasmid name   p10-2080.2 Incompatibility group   Col440I
Plasmid size   4418 bp Coordinate of oriT [Strand]   1396..1453 [-]
Host baterium   Salmonella enterica subsp. enterica serovar 14[5]12:i:- strain PNCS014855

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -