Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   114281
Name   oriT_FDAARGOS_692|unnamed1 in_silico
Organism   Shigella flexneri strain FDAARGOS_692
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP055133 (874..946 [-], 73 nt)
oriT length   73 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 73 nt

>oriT_FDAARGOS_692|unnamed1
GTCGGGGTGAAGCCCTGACCAAGTGGGGAATGTCTGAGTGCGCGTGCGCGGTCCGACATTCCCACATCCTGTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14716 GenBank   NZ_CP055133
Plasmid name   FDAARGOS_692|unnamed1 Incompatibility group   Col
Plasmid size   1538 bp Coordinate of oriT [Strand]   874..946 [-]
Host baterium   Shigella flexneri strain FDAARGOS_692

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -