Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 114268 |
| Name | oriT_FDAARGOS_748|unnamed3  |
| Organism | Staphylococcus hominis strain FDAARGOS_748 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP054885 (49..169 [-], 121 nt) |
| oriT length | 121 nt |
| IRs (inverted repeats) | 53..60, 62..69 (TTGGGGAT..ATCCCCAA) 22..29, 34..41 (ATTTTTTC..GAAAAAAT) 1..8, 14..21 (AGTGGCTA..TAGCCACT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 121 nt
>oriT_FDAARGOS_748|unnamed3
AGTGGCTAGCAATTAGCCACTATTTTTTCGTCAGAAAAAATCCATAAGGGGCTTGGGGATTATCCCCAACAAGCAGGCAACGCTACCACGTTAGTGGCTAGCAAAGCCAATGCTTGCCAAA
AGTGGCTAGCAATTAGCCACTATTTTTTCGTCAGAAAAAATCCATAAGGGGCTTGGGGATTATCCCCAACAAGCAGGCAACGCTACCACGTTAGTGGCTAGCAAAGCCAATGCTTGCCAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14703 | GenBank | NZ_CP054885 |
| Plasmid name | FDAARGOS_748|unnamed3 | Incompatibility group | - |
| Plasmid size | 9873 bp | Coordinate of oriT [Strand] | 49..169 [-] |
| Host baterium | Staphylococcus hominis strain FDAARGOS_748 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |