Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 114215
• Name: oriT_punmamed1
• Organism: Micromonospora sp. NBRC 110009
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP130428 (621..680 [-], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_punmamed1
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 14650
• GenBank: NZ_CP130428
• Plasmid name: punmamed1
• Incompatibility group: ColRNAI
• Plasmid size: 6137 bp
• Coordinate of oriT [Strand]: 621..680 [-]
• Host baterium: Micromonospora sp. NBRC 110009

Cargo genes

• Drug resistance gene: aph(3')-Ia
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -