Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   114210
Name   oriT_NM213|unnamed1 in_silico
Organism   Enterococcus faecium strain NM213
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP034950 (9831..9967 [-], 137 nt)
oriT length   137 nt
IRs (inverted repeats)      21..28, 42..49  (AAAAGGGG..CCCCTTTT)
 25..30, 39..44  (GGGGAA..TTCCCC)
Location of nic site      104..105
Conserved sequence flanking the
  nic site  
 
 GCTTGCAGTA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 137 nt

>oriT_NM213|unnamed1
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCCACATTGTAATACAAGAACGAAGTGCTTTGTATTACAATGTGATAGCTTGCAGTATTTATGGTTTTATATGGTCTATTTTGTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14645 GenBank   NZ_CP034950
Plasmid name   NM213|unnamed1 Incompatibility group   -
Plasmid size   37182 bp Coordinate of oriT [Strand]   9831..9967 [-]
Host baterium   Enterococcus faecium strain NM213

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -