Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   114176
Name   oriT_BL661|unnamed4 in_silico
Organism   Salmonella enterica subsp. enterica serovar 1412:i:- strain BL661
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP126183 (1420..1502 [+], 83 nt)
oriT length   83 nt
IRs (inverted repeats)      1..6, 15..20  (GGGGTG..CACCCC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 83 nt

>oriT_BL661|unnamed4
GGGGTGTCGGGGTGCACCCCTGACCAGATGGCAATTGTGATAGCGTCGCGTGTGACGGTATTACAATTACACATCCTGTCCCG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14611 GenBank   NZ_CP126183
Plasmid name   BL661|unnamed4 Incompatibility group   ColpVC
Plasmid size   2097 bp Coordinate of oriT [Strand]   1420..1502 [+]
Host baterium   Salmonella enterica subsp. enterica serovar 1412:i:- strain BL661

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -