Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 114156 |
| Name | oriT_pSNE1-2012K-0663  |
| Organism | Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0663 isolate USDA-ARS-USMARC-1936 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP025244 (2309..2368 [+], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pSNE1-2012K-0663
GGGTGTCGGGGCGCAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
GGGTGTCGGGGCGCAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14591 | GenBank | NZ_CP025244 |
| Plasmid name | pSNE1-2012K-0663 | Incompatibility group | ColRNAI |
| Plasmid size | 4593 bp | Coordinate of oriT [Strand] | 2309..2368 [+] |
| Host baterium | Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0663 isolate USDA-ARS-USMARC-1936 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |