Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 114156 |
Name | oriT_pSNE1-2012K-0663 |
Organism | Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0663 isolate USDA-ARS-USMARC-1936 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP025244 (2309..2368 [+], 60 nt) |
oriT length | 60 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pSNE1-2012K-0663
GGGTGTCGGGGCGCAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
GGGTGTCGGGGCGCAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 14591 | GenBank | NZ_CP025244 |
Plasmid name | pSNE1-2012K-0663 | Incompatibility group | ColRNAI |
Plasmid size | 4593 bp | Coordinate of oriT [Strand] | 2309..2368 [+] |
Host baterium | Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0663 isolate USDA-ARS-USMARC-1936 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |