Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 114129 |
| Name | oriT_WILCCON 0062|p1  |
| Organism | Ligilactobacillus faecis strain WILCCON 0062 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP123640 (1723..1762 [+], 40 nt) |
| oriT length | 40 nt |
| IRs (inverted repeats) | 15..22, 29..36 (AAAGTATA..TATACTTT) 2..8, 13..19 (ACTTTAC..GTAAAGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 40 nt
>oriT_WILCCON 0062|p1
CACTTTACGCAGGTAAAGTATAGTGGGTTATACTTTTACA
CACTTTACGCAGGTAAAGTATAGTGGGTTATACTTTTACA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14564 | GenBank | NZ_CP123640 |
| Plasmid name | WILCCON 0062|p1 | Incompatibility group | - |
| Plasmid size | 3012 bp | Coordinate of oriT [Strand] | 1723..1762 [+] |
| Host baterium | Ligilactobacillus faecis strain WILCCON 0062 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |