Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   114092
Name   oriT_pR18.0186_4.7k in_silico
Organism   Salmonella enterica subsp. enterica serovar Blockley strain R18.0186
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP100713 (3881..3940 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pR18.0186_4.7k
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14527 GenBank   NZ_CP100713
Plasmid name   pR18.0186_4.7k Incompatibility group   ColRNAI
Plasmid size   4657 bp Coordinate of oriT [Strand]   3881..3940 [-]
Host baterium   Salmonella enterica subsp. enterica serovar Blockley strain R18.0186

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -