Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   114090
Name   oriT_pR17.5474_4.0k in_silico
Organism   Salmonella enterica subsp. enterica serovar Typhimurium strain R17.5474
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP100717 (3712..3771 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pR17.5474_4.0k
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14525 GenBank   NZ_CP100717
Plasmid name   pR17.5474_4.0k Incompatibility group   ColRNAI
Plasmid size   3988 bp Coordinate of oriT [Strand]   3712..3771 [-]
Host baterium   Salmonella enterica subsp. enterica serovar Typhimurium strain R17.5474

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -