Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 114084 |
| Name | oriT_pR17.0904_4.0k  |
| Organism | Salmonella enterica subsp. enterica serovar Mbandaka strain R17.0904 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP100675 (2499..2558 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pR17.0904_4.0k
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14519 | GenBank | NZ_CP100675 |
| Plasmid name | pR17.0904_4.0k | Incompatibility group | ColRNAI |
| Plasmid size | 4018 bp | Coordinate of oriT [Strand] | 2499..2558 [-] |
| Host baterium | Salmonella enterica subsp. enterica serovar Mbandaka strain R17.0904 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |