Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   114082
Name   oriT_pR17.1476_6.1k in_silico
Organism   Salmonella enterica subsp. enterica serovar Enteritidis strain R17.1476
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP100727 (2439..2496 [+], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT_pR17.1476_6.1k
GGGTTTCGGGGCGAAGCCCTGAACCAGTCACGTAGCGATAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14517 GenBank   NZ_CP100727
Plasmid name   pR17.1476_6.1k Incompatibility group   ColRNAI
Plasmid size   6080 bp Coordinate of oriT [Strand]   2439..2496 [+]
Host baterium   Salmonella enterica subsp. enterica serovar Enteritidis strain R17.1476

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -