Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   114075
Name   oriT_pR17.3867_11k in_silico
Organism   Salmonella enterica subsp. enterica serovar Typhimurium strain R17.3867
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP100692 (4028..4187 [+], 160 nt)
oriT length   160 nt
IRs (inverted repeats)      39..44, 48..53  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 160 nt

>oriT_pR17.3867_11k
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14510 GenBank   NZ_CP100692
Plasmid name   pR17.3867_11k Incompatibility group   IncQ1
Plasmid size   11080 bp Coordinate of oriT [Strand]   4028..4187 [+]
Host baterium   Salmonella enterica subsp. enterica serovar Typhimurium strain R17.3867

Cargo genes


Drug resistance gene   tet(A), aph(6)-Id, aph(3'')-Ib, sul2
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -