Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   114037
Name   oriT_pA-10383D in_silico
Organism   Shigella flexneri 1b strain A-10383
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP130068 (837..911 [+], 75 nt)
oriT length   75 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 75 nt

>oriT_pA-10383D
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14472 GenBank   NZ_CP130068
Plasmid name   pA-10383D Incompatibility group   ColRNAI
Plasmid size   2690 bp Coordinate of oriT [Strand]   837..911 [+]
Host baterium   Shigella flexneri 1b strain A-10383

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -