Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 114035
• Name: oriT_pA-10383B
• Organism: Shigella flexneri 1b strain A-10383
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP130066 (749..808 [+], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_pA-10383B
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 14470
• GenBank: NZ_CP130066
• Plasmid name: pA-10383B
• Incompatibility group: ColRNAI
• Plasmid size: 4099 bp
• Coordinate of oriT [Strand]: 749..808 [+]
• Host baterium: Shigella flexneri 1b strain A-10383

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -