Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 114033 |
Name | oriT_pLACp01 |
Organism | Staphylococcus aureus strain BSN05 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_JATACE010000023 (2079..2267 [+], 189 nt) |
oriT length | 189 nt |
IRs (inverted repeats) | 149..156, 161..168 (CTATCATT..AATGATAG) 133..138, 142..147 (TCTGGC..GCCAGA) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 189 nt
>oriT_pLACp01
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAATAAGACAAACGCAATATATTGTGTCACAAAAATAAGACAGTACAGCTTTGTATGATATCACTTTAAAATACCTTAAAACCCCTGGAATTTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAATAAGACAAACGCAATATATTGTGTCACAAAAATAAGACAGTACAGCTTTGTATGATATCACTTTAAAATACCTTAAAACCCCTGGAATTTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 14468 | GenBank | NZ_JATACE010000023 |
Plasmid name | pLACp01 | Incompatibility group | - |
Plasmid size | 2981 bp | Coordinate of oriT [Strand] | 2079..2267 [+] |
Host baterium | Staphylococcus aureus strain BSN05 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |