Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   114024
Name   oriT_pSAP015A in_silico
Organism   Staphylococcus aureus strain BSN05
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JATACE010000018 (11841..12079 [+], 239 nt)
oriT length   239 nt
IRs (inverted repeats)      216..221, 231..236  (TTTTTA..TAAAAA)
 170..177, 182..189  (CTATCATT..AATGATAG)
 154..159, 163..168  (TCTGGC..GCCAGA)
 24..30, 44..50  (CTTTTTT..AAAAAAG)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 239 nt

>oriT_pSAP015A
AAGACATTAGTGTTGACTAATGTCTTTTTTGTTGATTTTTTATAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAATAAGACAGTACAGCTTTGTATGATATCACTTTAAAATACCTTAAAACCCCTGGAATTTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTACGGAGTTTTTAGAGAAAAATTAAAAATTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14459 GenBank   NZ_JATACE010000018
Plasmid name   pSAP015A Incompatibility group   -
Plasmid size   12553 bp Coordinate of oriT [Strand]   11841..12079 [+]
Host baterium   Staphylococcus aureus strain BSN05

Cargo genes


Drug resistance gene   msr(A), mph(C)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21