Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 114024 |
Name | oriT_pSAP015A |
Organism | Staphylococcus aureus strain BSN05 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_JATACE010000018 (11841..12079 [+], 239 nt) |
oriT length | 239 nt |
IRs (inverted repeats) | 216..221, 231..236 (TTTTTA..TAAAAA) 170..177, 182..189 (CTATCATT..AATGATAG) 154..159, 163..168 (TCTGGC..GCCAGA) 24..30, 44..50 (CTTTTTT..AAAAAAG) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 239 nt
>oriT_pSAP015A
AAGACATTAGTGTTGACTAATGTCTTTTTTGTTGATTTTTTATAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAATAAGACAGTACAGCTTTGTATGATATCACTTTAAAATACCTTAAAACCCCTGGAATTTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTACGGAGTTTTTAGAGAAAAATTAAAAATTC
AAGACATTAGTGTTGACTAATGTCTTTTTTGTTGATTTTTTATAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAATAAGACAGTACAGCTTTGTATGATATCACTTTAAAATACCTTAAAACCCCTGGAATTTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTACGGAGTTTTTAGAGAAAAATTAAAAATTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 14459 | GenBank | NZ_JATACE010000018 |
Plasmid name | pSAP015A | Incompatibility group | - |
Plasmid size | 12553 bp | Coordinate of oriT [Strand] | 11841..12079 [+] |
Host baterium | Staphylococcus aureus strain BSN05 |
Cargo genes
Drug resistance gene | msr(A), mph(C) |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | AcrIIA21 |