Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   114022
Name   oriT_FDAARGOS 1407|unnamed in_silico
Organism   Aeromonas sp. FDAARGOS 1407
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP077400 (1093..1252 [-], 160 nt)
oriT length   160 nt
IRs (inverted repeats)      39..44, 48..53  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 160 nt

>oriT_FDAARGOS 1407|unnamed
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14457 GenBank   NZ_CP077400
Plasmid name   FDAARGOS 1407|unnamed Incompatibility group   IncQ1
Plasmid size   6925 bp Coordinate of oriT [Strand]   1093..1252 [-]
Host baterium   Aeromonas sp. FDAARGOS 1407

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -