Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 114014 |
| Name | oriT_WiKim32|unnamed4  |
| Organism | Leuconostoc mesenteroides strain WiKim32 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP037754 (3099..3134 [+], 36 nt) |
| oriT length | 36 nt |
| IRs (inverted repeats) | 1..6, 17..22 (CACCAC..GTGGTG) |
| Location of nic site | 18..19 |
| Conserved sequence flanking the nic site |
TGTGTGGTGT |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 36 nt
>oriT_WiKim32|unnamed4
CACCACCAATTTATGTGTGGTGTGTAAGTGCGCATT
CACCACCAATTTATGTGTGGTGTGTAAGTGCGCATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14449 | GenBank | NZ_CP037754 |
| Plasmid name | WiKim32|unnamed4 | Incompatibility group | - |
| Plasmid size | 10187 bp | Coordinate of oriT [Strand] | 3099..3134 [+] |
| Host baterium | Leuconostoc mesenteroides strain WiKim32 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |