Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 114006 |
| Name | oriT_pSC77-1  |
| Organism | Streptococcus canis strain HL_77_1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP053793 (1957..2011 [+], 55 nt) |
| oriT length | 55 nt |
| IRs (inverted repeats) | 1..7, 9..15 (GTTGATA..TATCAAC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 55 nt
>oriT_pSC77-1
GTTGATATTATCAACTCCACACGGTACGTGGGGACAGTTTCCCTTATGCTCTTTT
GTTGATATTATCAACTCCACACGGTACGTGGGGACAGTTTCCCTTATGCTCTTTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14441 | GenBank | NZ_CP053793 |
| Plasmid name | pSC77-1 | Incompatibility group | - |
| Plasmid size | 4146 bp | Coordinate of oriT [Strand] | 1957..2011 [+] |
| Host baterium | Streptococcus canis strain HL_77_1 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |