Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   114006
Name   oriT_pSC77-1 in_silico
Organism   Streptococcus canis strain HL_77_1
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP053793 (1957..2011 [+], 55 nt)
oriT length   55 nt
IRs (inverted repeats)      1..7, 9..15  (GTTGATA..TATCAAC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 55 nt

>oriT_pSC77-1
GTTGATATTATCAACTCCACACGGTACGTGGGGACAGTTTCCCTTATGCTCTTTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14441 GenBank   NZ_CP053793
Plasmid name   pSC77-1 Incompatibility group   -
Plasmid size   4146 bp Coordinate of oriT [Strand]   1957..2011 [+]
Host baterium   Streptococcus canis strain HL_77_1

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -