Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 114002 |
| Name | oriT_p16005813C  |
| Organism | Leclercia adecarboxylata strain 16005813 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MK036885 (13231..13324 [+], 94 nt) |
| oriT length | 94 nt |
| IRs (inverted repeats) | 73..78, 84..89 (AAAAAA..TTTTTT) 27..34, 37..44 (AGCGTGAT..ATCACGCT) 13..19, 31..37 (TAAATCA..TGATTTA) |
| Location of nic site | 55..56 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 94 nt
>oriT_p16005813C
TTTTTTTTCTTTTAAATCAGTGGTATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTGGTAG
TTTTTTTTCTTTTAAATCAGTGGTATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14437 | GenBank | NZ_MK036885 |
| Plasmid name | p16005813C | Incompatibility group | IncR |
| Plasmid size | 61463 bp | Coordinate of oriT [Strand] | 13231..13324 [+] |
| Host baterium | Leclercia adecarboxylata strain 16005813 |
Cargo genes
| Drug resistance gene | catA1, blaCTX-M-9, sul1, qacE, catB8, tet(C) |
| Virulence gene | - |
| Metal resistance gene | merR, merT, merP, merC, merA, merD, merE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |