Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 113997 |
| Name | oriT_pYUI-1  |
| Organism | Pseudomonas aeruginosa strain PA-IMP-1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MH594579 (1780..1839 [+], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pYUI-1
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14432 | GenBank | NZ_MH594579 |
| Plasmid name | pYUI-1 | Incompatibility group | Col440II |
| Plasmid size | 21079 bp | Coordinate of oriT [Strand] | 1780..1839 [+] |
| Host baterium | Pseudomonas aeruginosa strain PA-IMP-1 |
Cargo genes
| Drug resistance gene | sul1, qacE, blaOXA-392, blaIMP-1 |
| Virulence gene | - |
| Metal resistance gene | merR, merT, merP, merA, merD, merE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |