Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   113997
Name   oriT_pYUI-1 in_silico
Organism   Pseudomonas aeruginosa strain PA-IMP-1
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_MH594579 (1780..1839 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pYUI-1
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14432 GenBank   NZ_MH594579
Plasmid name   pYUI-1 Incompatibility group   Col440II
Plasmid size   21079 bp Coordinate of oriT [Strand]   1780..1839 [+]
Host baterium   Pseudomonas aeruginosa strain PA-IMP-1

Cargo genes


Drug resistance gene   sul1, qacE, blaOXA-392, blaIMP-1
Virulence gene   -
Metal resistance gene   merR, merT, merP, merA, merD, merE
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -