Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 113985 |
| Name | oriT_pBP-33-3  |
| Organism | Bacillus pumilus strain 33-3 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MH539888 (4813..4836 [+], 24 nt) |
| oriT length | 24 nt |
| IRs (inverted repeats) | 1..7, 18..24 (ACCCCCC..GGGGGGT) 3..8, 18..23 (CCCCCC..GGGGGG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 24 nt
>oriT_pBP-33-3
ACCCCCCCACTCTAACAGGGGGGT
ACCCCCCCACTCTAACAGGGGGGT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14420 | GenBank | NZ_MH539888 |
| Plasmid name | pBP-33-3 | Incompatibility group | - |
| Plasmid size | 6432 bp | Coordinate of oriT [Strand] | 4813..4836 [+] |
| Host baterium | Bacillus pumilus strain 33-3 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |