Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   113975
Name   oriT_pAlvB in_silico
Organism   Hafnia paralvei strain VBC_1714
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JAEAGQ010000020 (3437..3496 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pAlvB
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACATAGCGCTAGCGAAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14410 GenBank   NZ_JAEAGQ010000020
Plasmid name   pAlvB Incompatibility group   -
Plasmid size   5343 bp Coordinate of oriT [Strand]   3437..3496 [-]
Host baterium   Hafnia paralvei strain VBC_1714

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -