Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 113973 |
| Name | oriT_pPH1-1  |
| Organism | Staphylococcus aureus strain ph1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MH785236 (9255..9375 [-], 121 nt) |
| oriT length | 121 nt |
| IRs (inverted repeats) | 53..59, 63..69 (TTGGGAT..ATCCCAA) 23..30, 35..42 (TTTTTTGC..GCAAAAAA) 1..8, 14..21 (AGTGGCTA..TAGCCACT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 121 nt
>oriT_pPH1-1
AGTGGCTAGCATTTAGCCACTCTTTTTTGCGTAAGCAAAAAACATAAAGGGCTTGGGATATAATCCCAACAAGCAGGCGATACTACCACGTTAGTGGCTAGCAAAGCCAATGCTTGCCAAA
AGTGGCTAGCATTTAGCCACTCTTTTTTGCGTAAGCAAAAAACATAAAGGGCTTGGGATATAATCCCAACAAGCAGGCGATACTACCACGTTAGTGGCTAGCAAAGCCAATGCTTGCCAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14408 | GenBank | NZ_MH785236 |
| Plasmid name | pPH1-1 | Incompatibility group | - |
| Plasmid size | 30962 bp | Coordinate of oriT [Strand] | 9255..9375 [-] |
| Host baterium | Staphylococcus aureus strain ph1 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21, AcrIIA15 |