Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   113965
Name   oriT_pPSTRAS1 in_silico
Organism   Pseudomonas aeruginosa strain 15.2986
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_MH463250 (8953..9112 [+], 160 nt)
oriT length   160 nt
IRs (inverted repeats)      39..44, 48..53  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 160 nt

>oriT_pPSTRAS1
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14400 GenBank   NZ_MH463250
Plasmid name   pPSTRAS1 Incompatibility group   IncQ1
Plasmid size   9910 bp Coordinate of oriT [Strand]   8953..9112 [+]
Host baterium   Pseudomonas aeruginosa strain 15.2986

Cargo genes


Drug resistance gene   aph(3')-VIa, blaCTX-M-3, ant(2'')-Ia
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -