Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   113958
Name   oriT_p5ASAL07_4.6k in_silico
Organism   Salmonella enterica subsp. enterica serovar Goldcoast strain 5ASAL07
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP090136 (4103..4162 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_p5ASAL07_4.6k
GGGTGTCGGGGCGCAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14393 GenBank   NZ_CP090136
Plasmid name   p5ASAL07_4.6k Incompatibility group   ColRNAI
Plasmid size   4593 bp Coordinate of oriT [Strand]   4103..4162 [-]
Host baterium   Salmonella enterica subsp. enterica serovar Goldcoast strain 5ASAL07

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -