Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 113954 |
| Name | oriT_FDAARGOS_716|unnamed3  |
| Organism | Shigella flexneri strain FDAARGOS_716 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP050987 (2214..2273 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_FDAARGOS_716|unnamed3
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14389 | GenBank | NZ_CP050987 |
| Plasmid name | FDAARGOS_716|unnamed3 | Incompatibility group | ColRNAI |
| Plasmid size | 3320 bp | Coordinate of oriT [Strand] | 2214..2273 [-] |
| Host baterium | Shigella flexneri strain FDAARGOS_716 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |