Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 113950 |
| Name | oriT_TMDU-41|p3  |
| Organism | Staphylococcus epidermidis strain TMDU-41 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP093168 (1234..1353 [-], 120 nt) |
| oriT length | 120 nt |
| IRs (inverted repeats) | 52..58, 62..68 (TTGGGGA..TCCCCAA) 22..29, 34..41 (ATTTTTTC..GAAAAAAT) 1..9, 13..21 (AGTGGCTAA..TTAGCCACT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 120 nt
>oriT_TMDU-41|p3
AGTGGCTAACAATTAGCCACTATTTTTTCGTCAGAAAAAATCATAAGGGGCTTGGGGATATTCCCCAACAAGCTGGCGCGTCTGCCACGTTAGTGGATAGCAAAGCCAATGCTTGCCAAA
AGTGGCTAACAATTAGCCACTATTTTTTCGTCAGAAAAAATCATAAGGGGCTTGGGGATATTCCCCAACAAGCTGGCGCGTCTGCCACGTTAGTGGATAGCAAAGCCAATGCTTGCCAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14385 | GenBank | NZ_CP093168 |
| Plasmid name | TMDU-41|p3 | Incompatibility group | - |
| Plasmid size | 8662 bp | Coordinate of oriT [Strand] | 1234..1353 [-] |
| Host baterium | Staphylococcus epidermidis strain TMDU-41 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |